You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
pgpB [2020-07-10 09:00:39]
phosphatidylglycerol phosphate (PGP) phosphatase , has minor undecaprenyl pyrophosphate phosphatase activity
Molecular weight
22.64 kDa
Function
phospholipid biosynthesis
Product
phosphatidylglycerol phosphate (PGP) phosphatase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,136,913 2,137,524
The protein
Catalyzed reaction/ biological activity
1,2-diacyl-sn-glycero-3-phospho-(1ʼ-sn-glycero-3ʼ-phosphate) + H2O --> 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) + phosphate (according to UniProt)Protein family
PA-phosphatase related phosphoesterase family (single member, according to UniProt)Structure
Localization
cell membrane (integral) PubMed Expression and Regulation
Biological materials
Mutant
MGNA-B441 (pgpB::erm), available at the NBRP B. subtilis, JapanBKE19650 (pgpB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGCBKK19650 (pgpB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATTTTAACCACCTCAATT, downstream forward: _UP4_TAGAGAGAGGAAAACACAGCGP3652 ΔpgpB::cat, available in Jörg Stülke's lab Expression vector
pGP3502: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pETSUMOadapt, available in Jörg Stülke's labpGP3503: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's labpGP3506 (N-terminal His-tag, expression in E. coli, in pWH844), available in Jörg Stülke's lab References
Loading